[SOLVED] CS4233 - Homework 1 Part II

39.99 $

Category: Tags: , ,
Click Category Button to View Your Next Assignment | Homework

You will receive the following solution file(s) instantly after successful payment:

zip file icon hw1-xxth1k.zip (2464 KB)
Assignment Instructions Updated Recently? Submit Below and we will provide new Solution!
Submit New Instructions
🔒 Securely Powered by:
Secure Checkout
5/5 - (2 votes)

: Open reading frame finder & codon bias analysis

An Open Reading Frame (ORF) is a continuous stretch of codons (nucleotide triplets) that contain a start codon (i.e., ATG) at the beginning and a stop codon (i.e., TAA, TAG or TGA) at the end only, i.e., with no stop codon in the middle (https://en.wikipedia.org/wiki/Open reading frame). Note that there are three different ways (frames) that you can convert a DNA strand into triplets, each shifting one nucleotide from another, and a total of six different ways to find ORFs on a double stranded sequence.

Problem 1 (5 points): Reverse complementary strand.
Write a MATLAB function getReverseComp that takes a string as a DNA sequence and return its reverse complementary strand. Save as file getReverseComp.m.

Test it on the command line by typing in: getReverseComp(‘ACGTGCA’) or run the corresponding cell in hw1script.m.

Problem 2 (2 points): Identify possible start codons.

Test it on the command line by typing in: findStartCodon(‘AATGTATGA’) or run the corresponding cell in hw1script.m.

Problem 3 (3 points): Identify possible stop codons.
Write a MATLAB function findStopCodon that takes a string as a DNA sequence, and returns the indices of all possible stop codons. The indices should be sorted. Save as file findStopCodon.m.

Test it on the command line by typing in: findStartCodon(‘ATAAGTAGGA’) or run the corresponding cell in hw1q2script.m.

Problem 4 (15 points) Identify the longest open reading frame (ORF)

Write a MATLAB function that takes as input a DNA sequence, and returns the longest ORF, which is given as two numbers (the start index of the start codon, and the END index of the stop codon). (The length = stop – start + 1 should be a multiple of 3.) Save this as file findLongestORF.m.

To test your function on the command line, type in:
findLongestORF(‘GGAGGCGTAAAATGCGTACTGGTAATGCAAACTAATGG’) or run the corresponding cell in hw1script.m.

Problem 5 (15 points) Find longest ORF and analyze codon bias

Save the subsequence corresponding to the longest ORF as a new variable, named longest_ORF.

Plot the codon distribution of longest_ORF using the codonbias function in MATLAB (with ‘pie’ plotting option set to “true”) (Save as Fig 1).

As a comparison, try to shift the ORF to the left or to the right by 1 base, and replot the codonbias (Display as Fig 2 and Fig 3).

Submission: upload your matlab .m files, and a short report with the following information

1. What is the start and end index of the longest ORF and which strand is it on?
2. What is the three most frequent amino acid encoded by the ORF? (Use MATLAB function nt2aa and aacount to find out.
3. Include the three codonbias plots with clear title.
4. In Fig 1, which codon is most frequently used for the amino acid Alanine and which codon is most frequently used for the amino acid Valine, and what are the percentage of usage?
5. In Fig 2 and Fig 3, what are the most frequent codons used for Alanine and Valine, respectively, and what are their percentages?

  • hw1-xxth1k.zip